BBa_J32015 1 PelB PelB leader sequence; directs protein to E. coli periplasmic membrane 2006-08-24T11:00:00Z 2015-08-31T04:08:46Z Novagen Released HQ 2013 The pelB leader sequence is a sequence of amino acids which when attached to a protein, directs the protein to the periplasmic membrane of E. coli, where the sequence is removed by pelB peptidase. It is used to direct coat protein-antigen fusions to the cell surface. false true _50_ 0 495 50 In stock true . true Austen Heinz annotation1898182 1 PelB range1898182 1 1 66 BBa_K2013000 1 BBa_K2013000 RBS and MHETase 2016-10-10T11:00:00Z 2016-10-11T06:18:40Z This sequence is from a bacterium called Ideonella sakaiensis 201-F6 This part contains the sequence of coding pelB signal peptide and PETase, Extracellular PETase can hydrolyze PET to MHET and TPA. This enzyme is an important step for us, which creates a new step hydrolyzing PET .PETase comes from a bacterium called Ideonella sakaiensis 201-F6 that Japanese scientists newly discovered.According to literature,The activity of the PETase protein against the PET film is 120, 5.5, and 88 times as high as that of TfH, LCC, and FsC that are close to PETase respectively.Therefore,PETase may be a promising enzyme that achieve effective degradation of PET.PETase in this bacterium is a secreted protein with a signal peptide. Through literatures, we found that the PelB signal peptide added 5 aspartate sequence can enhance the secretion of secreted protein. So we try to add pelB-5D before it to improve PETase secretion. Experimental Validation This part is validated through Four ways: amplification, PCR, Enzyme cutting and Sequence. Amplification Enzyme:KOD Primer-F:5′- GAATTCGCGGCCGCTTCTAGATGAAGTACCTGCTGCCGACCG-3′ Primer-R:5′- TCGTACCGCGAATTGCAGCTAATAATACTAGTAGCG-3′ Results PCR Enzyme:Taq Primer-F:5′-CCACCTGACGTCTAAGAAAC-3′ Primer-R:5′-GTATTACCGCCTTTGAGTGA-3′ Results Double digestion After the assembly ,the plasmid was transferred into the Competent E. coli top10. After culturing overnight in LB,we minipreped the plasmid for double digestion .The first cutting procedure was performed with EcoRI and EcoRV restriction endonuclease. The second cutting procedure was performed with PstI and NcoI restriction endonuclease. The plasmid was cutted in a 25μL system at 37 ℃ for 1 hours. The Electrophoresis was performed on a 1％ Agarose glu. Results true false _2480_ 32794 32794 9 false This is a coding part that encoding PETase. false Demin Xu component2491926 1 BBa_J32015 annotation2491926 1 BBa_J32015 range2491926 1 1 66 BBa_J32015_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc BBa_K2013000_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z