BBa_K2013002 1 BBa_K2013002 pelB and PETase 2016-10-11T11:00:00Z 2016-10-12T11:19:42Z This sequence is from a bacterium called Ideonella sakaiensis 201-F6 This part contains the sequence of coding pelB signal peptide and PETase, Extracellular PETase can hydrolyze PET to MHET and TPA. This enzyme is an important step for us, which creates a new step hydrolyzing PET .PETase comes from a bacterium called Ideonella sakaiensis 201-F6 that Japanese scientists newly discovered.According to literature,The activity of the PETase protein against the PET film is 120, 5.5, and 88 times as high as that of TfH, LCC, and FsC that are close to PETase respectively.Therefore,PETase may be a promising enzyme that achieve effective degradation of PET.PETase in this bacterium is a secreted protein with a signal peptide. Adding 5 aspartate sequence behind the PelB signal peptide can enhance the secretion of secreted protein. Experimental Validation This part is validated through Four ways: amplification, PCR, Enzyme cutting and Sequence. Amplification Enzyme:KOD Primer-F:5′- GAATTCGCGGCCGCTTCTAGATGAAGTACCTGCTGCCGACCG-3′ Primer-R:5′- TCGTACCGCGAATTGCAGCTAATAATACTAGTAGCG-3′ Results PCR Enzyme:Taq Primer-F:5′-CCACCTGACGTCTAAGAAAC-3′ Primer-R:5′-GTATTACCGCCTTTGAGTGA-3′ Results Double digestion After the assembly ,the plasmid was transferred into the Competent E. coli top10. After culturing overnight in LB,we minipreped the plasmid for double digestion .The first cutting procedure was performed with EcoRI and EcoRV restriction endonuclease. The second cutting procedure was performed with PstI and NcoI restriction endonuclease. The plasmid was cutted in a 25μL system at 37 ℃ for 1 hours. The Electrophoresis was performed on a 1％ Agarose glu. false false _2480_ 32794 31577 9 false This is a coding part that encoding PETase. false Binglin Liu annotation2493943 1 PelB-5D range2493943 1 1 81 annotation2496098 1 PETase range2496098 1 82 957 BBa_K2013002_sequence 1 atgaagtacctgctgccgaccgcggcggcgggtctgctgctgctggcggcgcagccggcgatggcggacgatgacgatgacatgaacttcccgcgtgcgagccgtctgatgcaggcggcggtgctgggtggcctgatggcggttagcgcggcggcgaccgcgcaaaccaacccgtatgcgcgtggtccgaacccgaccgcggcgagcctggaggcgagcgcgggtccgttcaccgtgcgtagctttaccgttagccgtccgagcggttacggtgcgggtaccgtgtactatccgaccaacgcgggtggcaccgtgggtgcgatcgcgattgttccgggttataccgcgcgtcagagcagcatcaaatggtggggtccgcgtctggcgagccacggttttgtggttatcaccattgataccaacagcaccctggaccagccgagcagccgtagcagccagcaaatggcggcgctgcgtcaagttgcgagcctgaacggtaccagcagcagcccgatctacggcaaggtggataccgcgcgtatgggcgttatgggttggagcatgggtggcggtggcagcctgattagcgcggcgaacaacccgagcctgaaagctgcggcgccgcaagcgccgtgggacagcagcaccaacttcagcagcgtgaccgttccgaccctgatctttgcgtgcgagaacgatagcattgcgccggtgaacagcagcgcgctgccgatctacgacagcatgagccgtaacgcgaagcagttcctggaaattaacggtggcagccacagctgcgcgaacagcggtaacagcaaccaagcgctgattggcaagaaaggtgtggcgtggatgaaacgtttcatggataacgacacccgttatagcacctttgcgtgcgaaaacccgaacagcacccgtgttagcgattttcgtaccgcgaattgcagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z