BBa_K2013004 1 BBa_K2013004 RBS and terephthalic acid(TPA) transporter 2016-10-11T11:00:00Z 2016-10-12T11:31:43Z This sequence is from a bacterium called Ideonella sakaiensis 201-F6 The sequence in this part is one of sequences encoding TPA transporter. Because of it,TPA will be transported from extracellular to intracellular.In addition，We carried out codon optimization on this part. Experimental Validation This part is validated through Four ways: amplification, PCR, Enzyme cutting and Sequence. Amplification Enzyme:Q5 Primer-F:5′GAATTCGCGGCCGCTTCTAGAGTACTAGAGTCACACAAGAAGGTACTAGATGAAG-3′ Primer-R:5′- CGCTACTAGTATTATTATTGGCCAAAAATGGTCGG-3′ Results PCR Enzyme:Taq Primer-F:5′-CCACCTGACGTCTAAGAAAC-3′ Primer-R:5′-GTATTACCGCCTTTGAGTGA-3′ Results Double digestion After the assembly ,the plasmid was transferred into the Competent E. coli top10. After culturing overnight in LB,we minipreped the plasmid for double digestion .The first cutting procedure was performed with EcoRI and NcoI restriction endonuclease. The second cutting procedure was performed with EcoRV and PstI restriction endonuclease. The plasmid was cutted in a 25μL system at 37 ℃ for 1 hours. The Electrophoresis was performed on a 1％ Agarose glu. Results false false _2480_ 32794 32794 9 false This is a Translational units part encoding TPA transporter. false Binglin Liu annotation2495625 1 RBS range2495625 1 1 13 annotation2496127 1 ISF6_0076 range2496127 1 20 487 BBa_K2013004_sequence 1 tcacacaagaaggtactagatgaagatcaaaagccagcgtgacttcgtggcgggtctgatgtttatcctggttggtattggcttcgcgtttggtgcgaccaactacagcatgggcaacagcgcgcgtccgggtccgggttatttcccgctgctgctgagcgtgatcctggcgattctgggttgcgtggttctgtttaagagcctgaccatcgaaaccgaaggtggcgacccgatcggtgcgattgcgtggcgtccgctgctgattaccgttgcgagcatcattgtgtacggtgttctgcaaccgcgtctgggtctgttcatcgcggtgccggttctgattgtgatggttagcttcgcgggtgatgagtttaaatggattggtgtgctggcgagcgcggtggttctgaccgttttcagctgggcggtgtttgtttatggtctgaacctgaccatcccgctgtggccgaccatttttggccaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z