BBa_K2013006 1 BBa_K2013006 transcriptional regulator 2016-10-11T11:00:00Z 2016-10-15T08:10:59Z This sequence is from a bacterium called Ideonella sakaiensis 201-F6 TphRI or tphRII, aIclR-type transcriptional regulator.In addition，We carried out codon optimization on this part. Experimental Validation This part is validated through Four ways: amplification, PCR, Enzyme cutting and Sequence. Amplification Enzyme:Q5 Primer-F:5′-GAATTCGCGGCCGCTTCTAGAGTACTAGAGTCACACAGGAGGGTACTAGATG-3′ Primer-R:5′- CGCTACTAGTATTATTACAGGCTACGACCCGCTG-3′ Results PCR Enzyme:Taq Primer-F:5′-CCACCTGACGTCTAAGAAAC-3′ Primer-R:5′-GTATTACCGCCTTTGAGTGA-3′ Results Double digestion After the assembly ,the plasmid was transferred into the Competent E. coli top10. After culturing overnight in LB,we minipreped the plasmid for double digestion .The first cutting procedure was performed with EcoRI and EcoRV restriction endonuclease. The second cutting procedure was performed with NcoI and PstI restriction endonuclease.The plasmid was cutted in a 25μL system at 37 ℃ for 1 hours. The Electrophoresis was performed on a 1％ Agarose glu. Results false false _2480_ 32794 32794 9 false This is a Translational units part that relates to TphRI or tphRII, aIclR-type transcriptional regulator. false Demin Xu annotation2495646 1 RBS range2495646 1 1 13 annotation2495647 1 ISF6_0225 range2495647 1 20 304 BBa_K2013006_sequence 1 tcacacaggagggtactagatggcggacaagaacttcgtgagcagcctggataaaggtctgcaagttctgggttgctttggccgtcaacacgcgcgtctgaccgtgagcgaggcggcgcgtctgaccggtagcaccccggcgagcgcgcgtcgtagcctgctgaccctgcaagcgctgggttacctggacagcgatggcaagcgtttctggatgctgccgaaagcgctgctgatcgcgcacgcgtatcaatttccgccggacgctgcggcgtgcgcggcagcagcgggtcgtagcctgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z