BBa_K2013009 1 BBa_K2013009 TPA 1,2-dioxygenase 2016-10-11T11:00:00Z 2016-10-15T08:12:35Z This sequence is from a bacterium called Ideonella sakaiensis 201-F6 This part contains one of sequences coding TPA 1,2-dioxygenase.This is the second. TPA is incorporated through the TPA transporter (TPATP) and catabolized by TPA 1,2-dioxygenase (TPADO).The result is that TPA is catabolized into 1,2-dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylate.In addition，We carried out codon optimization on this part Experimental Validation This part is validated through Four ways: amplification, PCR, Enzyme cutting and Sequence. Amplification Enzyme:KOD Primer-F:5′-GAATTCGCGGCCGCTTCTAGAGTACTAGAGTCACACAGGAGAGTACTAGATG-3′ Primer-R:5′- CGCTACTAGTATTATTACAGCGGCAGCGCCA-3′ Results PCR Enzyme:Taq Primer-F:5′-CCACCTGACGTCTAAGAAAC-3′ Primer-R:5′-GTATTACCGCCTTTGAGTGA-3′ Results Double digestion After the assembly ,the plasmid was transferred into the Competent E. coli top10. After culturing overnight in LB,we minipreped the plasmid for double digestion .The first cutting procedure was performed with EcoRI and NcoI restriction endonuclease. The second cutting procedure was performed with PstI and EcoRV restriction endonuclease.The plasmid was cutted in a 25μL system at 37 ℃ for 1 hours. The Electrophoresis was performed on a 1％ Agarose glu. Results false false _2480_ 32794 32794 9 false This is a Translational units part that relates to encode TPA 1,2-dioxygenase false Mei Deng annotation2496207 1 ISF6_0228 range2496207 1 20 487 annotation2495650 1 RBS range2495650 1 1 13 BBa_K2013009_sequence 1 tcacacaggagagtactagatgatcgacctgctggcgctgtgcgcgttcaacgcggcgtacgcggaaaccattgacagcgatgcgctggagcgttggccggatttctttaccgacgattgccactaccgtatcacccacgcggagaacgaacgtgagggtctggcggcgggtattgtgtatgcggacagccgtgcgatgctggaagatcgtatcgcggcgctgcgtgaagcgaacatttacgagcgtcagcgttatcgtcacctgctgggtatcccgctgctgggtgcgcaagacgataccggtgcggaagcgcgtaccccgttcatggtggcgcgtatcatggcgaccggtcagaccgagctgtttgcgagcggcatttatcgtgaccgtgtggttcgtcaagatggtggcctgcgtctgcgtagccgtgtggcggtttgcgacagcaccgttaccgataccctgctggcgctgccgctgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z