BBa_K2013021 1 BBa_K2013021 pelB-5D 2016-10-12T11:00:00Z 2016-10-12T11:13:51Z This idea is from <<Simple Amino Acid Tags Improve Both Expression and Secretion of Candida antarctica Lipase B in Recombinant Escherichia coli>> This part contains a special signal peptide that Enhance the secretion of secreted proteins. pelB is a signal peptide promoting protein secretion, through literatures we learn that adding 5 aspartate sequence behind it can enhance its function. Therefore,this part(pelB-5D) is a improvement??of existing of BBa_J32015(pelB) Experimental Validation This part is validated through five ways: amplification&#65292; PCR, Enzyme cutting, Sequence and SDS-PAGE. Amplification Enzyme:KOD Primer-F:5&#8242;- GAATTCGCGGCCGCTTCTAGATGAAGTACCTGCTGCCGACCG -3&#8242; Primer-R:5&#8242;-CCGCTACTAGTAGTCATCGTCATCGTCCGCCAT-3&#8242; Results PCR Enzyme:Taq Primer-F:5&#8242;-CCACCTGACGTCTAAGAAAC-3&#8242; Primer-R:5&#8242;-GTATTACCGCCTTTGAGTGA-3&#8242; Results Double digestion After the assembly ,the plasmid was transferred into the Competent E. coli top10. After culturing overnight in LB,we minipreped the plasmid for double digestion .The first cutting procedure was performed with EcoRI and EcoRV restriction endonuclease. The second cutting procedure was performed with PstI and NcoI restriction endonuclease.The plasmid was cutted in a 25&#956;L system at 37 &#8451; for 1 hours. The Electrophoresis was performed on a 1&#65285; Agarose glu. Results false false _2480_ 32794 32794 9 false This is a tag part that relates to secretion of secreted proteins false Binglin Liu annotation2496097 1 5D range2496097 1 67 81 annotation2496096 1 pelB range2496096 1 1 66 BBa_K2013021_sequence 1 atgaagtacctgctgccgaccgcggcggcgggtctgctgctgctggcggcgcagccggcgatggcggacgatgacgatgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z