BBa_K2014003 1 BBa_K2014003 pBAD-M5'UTR->sfGFP 2016-10-11T11:00:00Z 2016-10-14T02:09:22Z Arabinose induced promoter pBAD is a fragment of E.coli K-12 genome. The original 5'UTR region is replaced by synthetic unstructured sequence with a well positioned RBS previously tested on melibiose promoter from E.coli K-12 in 2015. Ara1-UTR promoter is made on the basis of two of our previous biobricks. Arashort1, which is an arabinose induced promoter without AraC factor (BBa_K1741000), was used as a base, because it is much shorter than wild type (araC-araBAD), but still provides the same, or even higher, protein expression. By using specially designed primers, we have deleted the original 5???UTR from Arashort1 and replaced it with synthetic 5???UTR, which was previously used in melibiose induced promoter- Mel2 (BBa_K1741004). This synthetic 5???UTR was built by removing potential secondary structures- which involved RBS. Furthermore, RBS has also been better positioned- 7 nt upstream from AUG start codon. false false _2481_ 27987 28000 9 false We designed shortened arabinose induced promoter with modified 5'UTR to provide higher expression level. false Daria Niewiadomska annotation2506704 1 M5'UTR range2506704 1 284 309 annotation2506710 1 -10 signal range2506710 1 269 273 annotation2506708 1 O1 region range2506708 1 158 179 annotation2506706 1 HisTag range2506706 1 310 339 annotation2506711 1 O2 region range2506711 1 1 16 annotation2506715 1 CAP binding site range2506715 1 203 213 annotation2506716 1 -35 signal range2506716 1 245 249 annotation2506714 1 i1-i2 range2506714 1 205 247 annotation2506705 1 ht-sfGFP range2506705 1 310 1059 BBa_K2014003_sequence 1 aaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaacccaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatattcaagcaagccaggagatatatcatatgggcagcagccatcatcatcatcatcatatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z