BBa_K2014004 1 BBa_K2014004 pxylS-M5'UTR->sfGFP 2016-10-11T11:00:00Z 2016-10-14T02:17:45Z Xylose induced promoter is a fragment of E.coli K-12 genome. Synthetic 5'UTR is a synthetic unstructured sequence with well positioned RBS. Genes involved in catabolism of xylose in E.coli are organized into two transcription units, which drive the transcription in opposite directions, by two promoters - XylA and XylF. During last iGEM edition, we performed many modifications of the initial promoter. XylA1 promoter (BBa_K1741007) was built by changing the original 5???UTR in XylA promoter for 5???UTR derived from constitutive proD promoter. The next step was to reduce the promoter???s size by removing its XylF part while keeping the modified 5'UTR (from proD) in XylA part- XylS promoter (BBa_K1741009). And this promoter became our base for XylS-UTR promoter construction, which consist of XylA part with edited 5???UTR. As above in the Ara1-UTR promoter, here again we replaced 5???UTR with synthetic 5???UTR, derived from Mel2 promoter(BBa_K1741004). false false _2481_ 28000 28000 9 false We decided to work on xylose induced promoter cause this sugar is relatively cheap. false Daria Niewiadomska annotation2506741 1 M 5'UTR range2506741 1 93 119 annotation2506725 1 XylR binding site range2506725 1 40 55 annotation2506735 1 CRP binding site range2506735 1 1 19 annotation2506721 1 XylR binding site range2506721 1 20 34 annotation2506729 1 -35 signal range2506729 1 56 60 annotation2506739 1 His - Tag range2506739 1 120 149 annotation2506743 1 ht-sfGFP range2506743 1 120 869 annotation2506732 1 -10 signal range2506732 1 79 84 BBa_K2014004_sequence 1 tgcgagcgagcgcacacttgtgaattatctcaatagcagtgtgaaataacataattgagcaactgaaagggagtgcccaatattacgacatcattcaagcaagccaggagatatatcatatgggcagcagccatcatcatcatcatcatatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z