BBa_K2016000 1 BBa_K2016000 Strong constitutive E. coli promoter with included RBS - ready for cloning 2016-10-06T11:00:00Z 2016-10-18T03:11:49Z source description false false _2483_ 31363 31363 9 Not in stock false Strong promoter included at the beginning of the sequence, followed by a spacer, followed by an rbs site. E. coli optimised, cloned between XbaI and SpeI sites. false Magdalena Dabrowska annotation2516634 1 Strong promoter J23100 range2516634 1 1 35 annotation2516635 1 Ribosomal Binding site range2516635 1 86 91 BBa_K2016000_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcgggagaccacaacggtttccctccagaaatagctttgtttaactttaagaaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z