BBa_K2018023 1 BBa_K2018023 hlyA secretion tag 2016-06-15T11:00:00Z 2016-06-23T07:14:33Z Escherichia coli The last part of the gene from hemolysin toxin, which marks the protein for secretion by the type II hemolysin pathway false false _2485_ 30983 30983 9 false Doesn't contain a start codon as it is meant for biofusion false Joel Vej-Nielsen BBa_K2018023_sequence 1 ttagcctatggaagtcagggtgatcttaatccattaattaatgaaatcagcaaaatcatttcagccgcaggtagcttcgatgttaaagaggaaagaactgccgcttctttattgcagttgtccggtaatgccagtgatttttcatatggacggaactcaataaccctgaccacatcagcatagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z