BBa_K2018044 1 BBa_K2018044 MaSp2 CD 2016-10-06T11:00:00Z 2016-10-07T09:59:19Z Made from SDU iGEM team 2016, from the spider Nephilia Clavipes This is a component that have specific overhangs for bacteriocines made by the universitet of southern Denmark iGEM team 2016. Bacto-Aid. false false _2485_ 31345 31345 9 false not best ligation with only 4bp on room temperature. Should have been extented. false Rune ??bo annotation2524619 1 BsaI range2524619 1 8 11 annotation2524618 1 BsaI range2524618 1 109 112 annotation2524617 1 dna range2524617 1 8 112 BBa_K2018044_sequence 1 ggtctcacgtgggaggctatggacctggtcagcaaggtccaggaggatatggaccaggacaacaaggaccatcaggaccaggatcagcagcagcagcagccgcagccgcgctatgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z