BBa_K201999 1 BBa_K201999 To be Deleted 2009-10-07T11:00:00Z 2015-05-08T01:11:22Z mnbjhvgfxdfzs hfdtcdgfdrdredstdt true false _325_ 0 1691 9 Discontinued false njkhgyfrts false francesca ceroni component2034418 1 BBa_K079019 component2034417 1 BBa_J23118 annotation2034417 1 BBa_J23118 range2034417 1 1 35 annotation2034418 1 BBa_K079019 range2034418 1 44 64 BBa_K079019 1 BBa_K079019 Lac 2 - operator library member 2008-10-23T11:00:00Z 2015-05-08T01:08:33Z Geneart synthesis service the false false _185_ 0 3530 9 Not in stock true The BBa_K079019 part was designed as the Lac operator 2 sequence flanked by the standard Prefix and Suffix. false Francesca Ceroni BBa_J23118 1 BBa_J23118 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K201999_sequence 1 ttgacggctagctcagtcctaggtattgtgctagctactagagaaatgtgagcgagtaacaacc BBa_J23118_sequence 1 ttgacggctagctcagtcctaggtattgtgctagc BBa_K079019_sequence 1 aaatgtgagcgagtaacaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z