BBa_K202002 1 M5 TNN Hybrid promoter having multiple operator sites. 2009-10-15T11:00:00Z 2015-05-08T01:11:22Z synthesized using tetO2 (mutation at position 5) and lacO1. Promoter was designed according to the Lutz R and Bujard H.(Nucleic Acids Res. 1997 Mar 15;25(6):1203-10). The operator sequences are from three unrelated natural regulatory elements: the tetracycline (tet), lactose (lac) and λ-phage operons arranged logically within a single transcriptional unit. The regulatory architecture is designed such that each operator's position efficiently interferes with RNA polymerase (RNAp) promoter binding without inhibiting promoter function. This promoter has tetO2 sites which are having transverse mutation at position 5. The hybrid promoter is cloned upstream to the GFP (part Bba_E0240) in plasmid pSBA1. It is ready for assay. false false _299_ 0 5266 9 It's complicated false The regulatory architecture is designed such that each operator's position efficiently interferes with RNA polymerase (RNAp) promoter binding without inhibiting promoter function. false Poonam Srivastava BBa_K202002_sequence 1 ctaatagtactcacggcgcaataccagcacagcctagtctcgccagaatgctggtcagcatacgaaagagcttaaggcaggccaattcgcactgtcagggtcacttgggtgtttagcatcccaatcagtgattgagattgacagagtcacaaagactcacgatactaatggaaggcatcgattagcaggaaaccggttcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z