BBa_K2020026 1 BBa_K2020026 secretion tag for <i>Saccharomyces cerevisiae</i> 2016-10-12T11:00:00Z 2016-10-13T07:04:27Z It is the alpha mating factors secretion tag, which is naturally occurring in the <i>Saccharomyces cerevisiae</i> genome. Secretion tag for use in <i>Saccharomyces cerevisiae</i>. It can be cloned directly in front of the protein one wants to be secreted. It will be relocated into the medium and the tag will be cleaved off in the process. false false _2487_ 30582 30582 9 false The sequence contained an illegal restriction site, which had to be corrected via PCR. false Katja Schr??der annotation2497404 1 secretion tag from alfa mating factor range2497404 1 1 263 BBa_K2020026_sequence 1 tgagatttccttcaatttttactccagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttacttagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctttggataaaagagaggctgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z