BBa_K202003 1 M3 TTL Hybrid promoter having multiple operator sites. 2009-10-18T11:00:00Z 2015-05-08T01:11:22Z The promoter was obtained by artificial synthesis. SOEing PCR was first done to combine two 111 base pair oligos, followed by the nested PCR. This strategy generated a 203 base pair hybrid promoter. This was directly cloned into pGLOW TOPO plasmid, upstream to the GFP cycle3. Biobrick suffix and prefix were later introduced through PCR and promoter fragment was cloned in plasmid pSBA1 upstream to the part E0240. Promoter was designed according to the Lutz R and Bujard H.(Nucleic Acids Res. 1997 Mar 15;25(6):1203-10). The operator sequences are from three unrelated natural regulatory elements: the tetracycline (tet), lactose (lac) and λ-phage operons arranged logically within a single transcriptional unit. The regulatory architecture is designed such that each operator's position efficiently interferes with RNA polymerase (RNAp) promoter binding without inhibiting promoter function. This promoter has tetO2 sites which are having transverse mutation at position 3. The hybrid promoter is cloned upstream to the GFP (part Bba_E0240) in plasmid pSBA1 false false _299_ 0 5266 9 It's complicated false 111 base pair oligos were designed for SOEing PCR with 18 base pair flanking region. false Poonam Srivastava BBa_K202003_sequence 1 ctaatagtactcacggcgcaataccagcacagcctagtctcgccagaatgctggtcagcatacgaaagagcttaaggcaggccaattcgcactgtcagggtcacttgggtgtttagcatccctaacagtgttagagattgacatccctaacagtgttagagatactattgtgagcggataacaattaggaaaccggttcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z