BBa_K2020042 1 BBa_K2020042 Mj-tRNA with amber anticodon for incorporating ncAA in E.coli 2016-10-01T11:00:00Z 2016-10-16T04:54:27Z wild type tyrosyl Methanococcus janaschii tRNA:Synthetase-pair with anticodon changed to Amber Anticodon CTA For incorporating unnatural amino acids into a protein, a orthogonal tRNA:Synthetase-pair is needed. This tRNA derives from wild type tyrosyl Methanococcus janaschii tRNA:Synthetase pair. It is used together with a tRNA-Synthetase in E.coli. The tRNA has an amber anticodon for incorporating the ncAA in response to an amber codon. It has been proven to work with (enter links for parts) wild type Y-RS, AzF-RS, CNF-RS, Iodo-Y-RS, 5HTP-RS, Nitro-Y-RS by iGEM-Team Texas 2014 (Link). false false _2487_ 29923 29923 9 true Since tRNA and Synthetases have own promotors and since they are frequently used in low copy plasmids, you should assemble tRNA and Syntehtases on a plasmid (e.g. pACYC) which fits your needs. Team Aachen 2016 ( http://2016.igem.org/Team:Aachen ) used tRNA in pACYC with p15A-ORI, Ipp-Promoter, Gent-Resistance. Together with an ncAA-Synthetase (For example: BBa_K2020050) with own promoter. false Andrea Hoeltken, Vroni Czotscher, Carolina Bonerath annotation2485610 1 tRNA range2485610 1 1 77 BBa_K2020042_sequence 1 ccggcggtagttcagcagggcagaacggcggactctaaatccgcaggtcgctggttcaaatccggcccgccggacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z