BBa_K2022000 1 g3p N1 Attachment Protein g3p, N-terminal Domain 2016-09-26T11:00:00Z 2016-10-08T02:45:00Z The sequence for this part use was taken from Henry et al (2004), which listed it as residues 1-71 of Attachment Protein g3p from the M13 phage. We took those residues from the Uniprot entry on the protein, and reverse translated using the E. coli codon-optimisation tool (Stothard, 2000). It is worth noting that their version also fused a 6-His tag to the C-terminus; we made this construct as a separate part. Expression of this part is suggested to induce hypervesiculation in E. coli (Henry et al, 2004), i.e. direct the bacterium to overproduce outer membrane vesicles (OMVs). References: Henry, T., Pommier, S., Journet, L., Bernadac, A., Gorvel, J.P. and Lloub??s, R., 2004. Improved methods for producing outer membrane vesicles in Gram-negative bacteria. Research in Microbiology, 155, pp.437-446. Stothard, P., 2000. The Sequence Manipulation Suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques, 28, pp.1102-1104. false false _2489_ 31054 31054 9 false As mentioned in the source section, we reverse translated the amino acid sequence using an E. coli codon-optimisation tool (Stothard, 2000). To codon optimise, however, this tool converts each amino acid to its most commonly used codon, rather than distributing across the degenerate codons proportional to their usage by E. coli (e.g. if an amino acid is coded by two codons, typically distributed 3:2 in other E. coli proteins, then all the amino acids in the optimised sequence will use the most abundant codon and never one of lesser abundance). This may not be ideal, hence alternative tools may be used in the future We also added a double stop (TAATAA) to terminate translation, for added stringency, something not included in the original sequence. Further, we opted to include two versions in the registry: one with, and one without a his-tag. The aim here was provide future users with flexibility and choice false Gavin Sutton, Shivani Shah annotation2485084 1 Start range2485084 1 1 3 annotation2485085 1 Double Stop range2485085 1 217 222 BBa_K2022000_sequence 1 atgatgaaaaaactgctgtttgcgattccgctggtggtgccgttttatagccatagcgcggaaaccgtggaaagctgcctggcgaaaccgcataccgaaaacagctttaccaacgtgtggaaagatgataaaaccctggatcgctatgcgaactatgaaggctgcctgtggaacgcgaccggcgtggtggtgtgcaccggcgatgaaacccagtgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z