BBa_K2022001 1 BBa_K2022001 Attachment Protein g3p, N-terminal Domain, His-tag 2016-10-09T11:00:00Z 2016-10-12T06:39:42Z See: http://parts.igem.org/wiki/index.php?title=Part:BBa_K2022000 A variant of part BBa_2022000, with a C-terminus His-tag for easier antibody-based recognition. Please see that page for full details: http://parts.igem.org/wiki/index.php?title=Part:BBa_K2022000 false false _2489_ 31054 31054 9 false See: http://parts.igem.org/wiki/index.php?title=Part:BBa_K2022000 The his-tag was created by adding six histidine residues just prior to double stop codons that stop translation. The DNA sequence for these six His residues is catcaccatcaccatcac, which is (roughly) E. coli codon optimised by balancing between the two codons for His false Gavin Sutton, Shivani Shah annotation2491732 1 start range2491732 1 1 3 annotation2491733 1 double stop range2491733 1 235 240 annotation2491734 1 his-tag range2491734 1 217 234 BBa_K2022001_sequence 1 atgatgaaaaaactgctgtttgcgattccgctggtggtgccgttttatagccatagcgcggaaaccgtggaaagctgcctggcgaaaccgcataccgaaaacagctttaccaacgtgtggaaagatgataaaaccctggatcgctatgcgaactatgaaggctgcctgtggaacgcgaccggcgtggtggtgtgcaccggcgatgaaacccagtgccatcaccatcaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z