BBa_K2022003 1 BBa_K2022003 TolR, Periplasmic Domain, His-tag 2016-10-10T11:00:00Z 2016-10-10T11:02:46Z See: http://parts.igem.org/wiki/index.php?title=Part:BBa_K2022002 A variant of part BBa_2022002, with a C-terminus His-tag for easier antibody-based recognition. Please see that page for full details: http://parts.igem.org/wiki/index.php?title=Part:BBa_K2022002 false false _2489_ 31054 31054 9 false See: http://parts.igem.org/wiki/index.php?title=Part:BBa_K2022002 The his-tag was created by adding six histidine residues just prior to double stop codons that stop translation. The DNA sequence for these six His residues is catcaccatcaccatcac, which is (roughly) E. coli codon optimised by balancing between the two codons for His false Gavin Sutton annotation2491736 1 double stop range2491736 1 244 249 annotation2491735 1 start range2491735 1 1 3 annotation2491737 1 his-tag range2491737 1 226 243 BBa_K2022003_sequence 1 atggaggtcgatctgccagacgctactgaatcacaggcggtgagcagtaacgataatccgccagtgattgttgaagtgtctggtattggtcagtacaccgtggtggttgagaaagatcgcctggagcgtttaccaccagagcaggtggtggcggaagtgtccagccgtttcaaggccaacccgaaaacggtctttctgatcggtggcgcaaaagatgtgccttaccatcaccatcaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z