BBa_B0017 1 BBa_B0017 double terminator (B0010-B0010) 2004-01-08T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator with two copies of <bb_part>BBa_B0010</bb_part> false false _1_ 0 24 7 In stock false true Austin Che component939331 1 BBa_B0010 component939337 1 BBa_B0010 annotation939331 1 BBa_B0010 range939331 1 1 80 annotation939337 1 BBa_B0010 range939337 1 89 168 BBa_K2022000 1 g3p N1 Attachment Protein g3p, N-terminal Domain 2016-09-26T11:00:00Z 2016-10-08T02:45:00Z The sequence for this part use was taken from Henry et al (2004), which listed it as residues 1-71 of Attachment Protein g3p from the M13 phage. We took those residues from the Uniprot entry on the protein, and reverse translated using the E. coli codon-optimisation tool (Stothard, 2000). It is worth noting that their version also fused a 6-His tag to the C-terminus; we made this construct as a separate part. Expression of this part is suggested to induce hypervesiculation in E. coli (Henry et al, 2004), i.e. direct the bacterium to overproduce outer membrane vesicles (OMVs). References: Henry, T., Pommier, S., Journet, L., Bernadac, A., Gorvel, J.P. and Lloub??s, R., 2004. Improved methods for producing outer membrane vesicles in Gram-negative bacteria. Research in Microbiology, 155, pp.437-446. Stothard, P., 2000. The Sequence Manipulation Suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques, 28, pp.1102-1104. false false _2489_ 31054 31054 9 false As mentioned in the source section, we reverse translated the amino acid sequence using an E. coli codon-optimisation tool (Stothard, 2000). To codon optimise, however, this tool converts each amino acid to its most commonly used codon, rather than distributing across the degenerate codons proportional to their usage by E. coli (e.g. if an amino acid is coded by two codons, typically distributed 3:2 in other E. coli proteins, then all the amino acids in the optimised sequence will use the most abundant codon and never one of lesser abundance). This may not be ideal, hence alternative tools may be used in the future We also added a double stop (TAATAA) to terminate translation, for added stringency, something not included in the original sequence. Further, we opted to include two versions in the registry: one with, and one without a his-tag. The aim here was provide future users with flexibility and choice false Gavin Sutton, Shivani Shah annotation2485085 1 Double Stop range2485085 1 217 222 annotation2485084 1 Start range2485084 1 1 3 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2129433 1 RBS range2129433 1 24 27 annotation2127788 1 B0034 range2127788 1 21 32 annotation2129432 1 T7 promoter range2129432 1 1 20 BBa_K2022007 1 BBa_K2022007 T7 Expression Construct for g3p N-terminal Domain 2016-10-12T11:00:00Z 2016-10-13T05:21:56Z An assembly of BBa_K525998 - BBa_K2022000 - BBa_B0017 This part contains g3p, N-terminal Domain (BBa_K2022000) under the control of a strong T7 promoter and RBS (both from BBa_K525998). Also included is double terminator (BBa_B0017). false false _2489_ 31054 31054 9 false We opted to use a T7 promoter to express g3p, as in many expression strains of E. coli (those that are DE3), T7 polymerase is IPTG-inducible. This, ultimately, allows the control of g3p expression, which is critical when the protein has the potential to harm the cell if overexpressed to too great an extent false Gavin Sutton component2497262 1 BBa_K525998 component2497270 1 BBa_B0017 component2497265 1 BBa_K2022000 annotation2497270 1 BBa_B0017 range2497270 1 269 436 annotation2497265 1 BBa_K2022000 range2497265 1 39 260 annotation2497262 1 BBa_K525998 range2497262 1 1 32 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0017_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_K2022007_sequence 1 taatacgactcactatagggaaagaggagaaatactagatgatgaaaaaactgctgtttgcgattccgctggtggtgccgttttatagccatagcgcggaaaccgtggaaagctgcctggcgaaaccgcataccgaaaacagctttaccaacgtgtggaaagatgataaaaccctggatcgctatgcgaactatgaaggctgcctgtggaacgcgaccggcgtggtggtgtgcaccggcgatgaaacccagtgctaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2022000_sequence 1 atgatgaaaaaactgctgtttgcgattccgctggtggtgccgttttatagccatagcgcggaaaccgtggaaagctgcctggcgaaaccgcataccgaaaacagctttaccaacgtgtggaaagatgataaaaccctggatcgctatgcgaactatgaaggctgcctgtggaacgcgaccggcgtggtggtgtgcaccggcgatgaaacccagtgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z