BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2127788 1 B0034 range2127788 1 21 32 annotation2129432 1 T7 promoter range2129432 1 1 20 annotation2129433 1 RBS range2129433 1 24 27 BBa_K2022002 1 BBa_K2022002 TolR, Periplasmic Domain 2016-10-07T11:00:00Z 2016-10-08T02:47:48Z Derived from the genomic sequence of E. coli K12, but with added N-terminal ATG (to start translation), and C-terminal TAATAA (to stop translation). Residues 44-117 of the tolR protein from E. coli, with added start and double stops. Overexpression of this part is known to stimulate formation of outer-membrane vesicles (OMVs) (Henry et al., 2004). false false _2489_ 31054 31054 9 false As the sequence came from E. coli's genome, evolution has likely already made it codon optimised. However, this is only a single domain of the protein, hence start and stop codons had to be artificially added to ensure it is a proper coding sequence. A previous team attempted to submit this part to the registry (BBa_K257005, by Paris 2009), but forgot to add the start codon; we thus submit this part to amend that error. Another improvement we made was to add a second stop codon at the c-terminus, to more stringently terminate translation. false Gavin Sutton BBa_B0017 1 BBa_B0017 double terminator (B0010-B0010) 2004-01-08T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator with two copies of <bb_part>BBa_B0010</bb_part> false false _1_ 0 24 7 In stock false true Austin Che component939331 1 BBa_B0010 component939337 1 BBa_B0010 annotation939331 1 BBa_B0010 range939331 1 1 80 annotation939337 1 BBa_B0010 range939337 1 89 168 BBa_K2022008 1 BBa_K2022008 T7 Expression Construct for tolR, Periplasmic Domain 2016-10-12T11:00:00Z 2016-10-13T05:36:16Z An assembly of BBa_K525998 - BBa_K2022002 - BBa_B0017 This part contains tolR, Periplasmic Domain (BBa_K2022002) under the control of a strong T7 promoter and RBS (both from BBa_K525998). Also included is double terminator (BBa_B0017). false false _2489_ 31054 31054 9 false We opted to use a T7 promoter to express g3p, as in many expression strains of E. coli (those that are DE3), T7 polymerase is IPTG-inducible. This, ultimately, allows the control of tolR expression, which is critical when the protein has the potential to harm the cell if overexpressed to too great an extent (as one could imagine being the case with vesicle formation) false Gavin Sutton component2497295 1 BBa_K525998 component2497296 1 BBa_K2022002 component2497301 1 BBa_B0017 annotation2497296 1 BBa_K2022002 range2497296 1 39 269 annotation2497295 1 BBa_K525998 range2497295 1 1 32 annotation2497301 1 BBa_B0017 range2497301 1 278 445 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0017_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_K2022008_sequence 1 taatacgactcactatagggaaagaggagaaatactagatggaggtcgatctgccagacgctactgaatcacaggcggtgagcagtaacgataatccgccagtgattgttgaagtgtctggtattggtcagtacaccgtggtggttgagaaagatcgcctggagcgtttaccaccagagcaggtggtggcggaagtgtccagccgtttcaaggccaacccgaaaacggtctttctgatcggtggcgcaaaagatgtgccttactaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2022002_sequence 1 atggaggtcgatctgccagacgctactgaatcacaggcggtgagcagtaacgataatccgccagtgattgttgaagtgtctggtattggtcagtacaccgtggtggttgagaaagatcgcctggagcgtttaccaccagagcaggtggtggcggaagtgtccagccgtttcaaggccaacccgaaaacggtctttctgatcggtggcgcaaaagatgtgccttactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z