BBa_K2022010 1 BBa_K2022010 RFP, with Periplasm-localisation Tag 2016-10-10T11:00:00Z 2016-10-11T05:48:13Z The sequence for RFP was the open reading frame of BBa_J04450. To its n-terminus we affixed a 20AA sec-signal tag, which guides the fusion protein to the periplasm. Red Fluorescent Protein (RFP) is widely-used reporter protein with an absorption and emission maxima at 555nm and 585nm, respectively. This part fuses a sec-signal tag to RFP's n-terminus, which helps export the fusion product to the periplasm and thus bias its subcellular localisation there. false false _2489_ 31054 31054 9 false Translation begins at the Met of the signal tag, before continuing into the RFP protein. We ultimately decided to keep the Met that begins RFP, as we couldn't find any evidence to suggest it is cleaved off in the mature, fully-processed form. false Jessica Mazalo, Daniel Winter annotation2491875 1 RFP range2491875 1 67 747 annotation2491889 1 double stop range2491889 1 742 747 annotation2491873 1 start range2491873 1 1 3 annotation2491872 1 Sec signal peptide range2491872 1 1 66 BBa_K2022010_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z