BBa_I723018 1 Pr Pr (promoter for XylR) 2007-10-24T11:00:00Z 2015-08-31T04:07:54Z [Christine/Maia] This is the naturally-occurring (possibly stationary-phase only) promoter for the XylR gene (which encodes the transcriptional regulator XylR). false false _126_ 0 2140 9 Not in stock false [Christine/Maia] false Scott Ramsay annotation1955191 1 Pr range1955191 1 1 410 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2023004 1 BBa_K2023004 Pr-RBS 2016-10-13T11:00:00Z 2016-10-19T07:14:21Z IDT synthesis Pr-RBS false false _2490_ 30356 30230 9 false balbla false C??lia Chenebault component2517442 1 BBa_I723018 component2517444 1 BBa_B0034 annotation2517444 1 BBa_B0034 range2517444 1 419 430 annotation2517442 1 BBa_I723018 range2517442 1 1 410 BBa_K2023004_sequence 1 attttaatgtgggctgcttggtgtgatgtagaaaggcgccaagtcgatgaaaatgcatctcgacgtgatgcgtatacgggttacccccattgccacgttgcgccatcctttttgcaatcagtgaccacttttccaagcaaaaataacgccaagcagaacgaagacgttctttttaagaagcgagaacaccagaagttcgtgctgtcggggcatgcggcgacgaattggcggataaaggggatctgcgttgaggtggatttcagttaatcaattggttaatctttcaggaccacctaagcaaatgctaaagtggcagatggaatgctgagccggcaagcacaggccttgacgttgcaaggtagtcatgaccgcagtgagcctctgatgttccgccgggtggatcatcccgatactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_I723018_sequence 1 attttaatgtgggctgcttggtgtgatgtagaaaggcgccaagtcgatgaaaatgcatctcgacgtgatgcgtatacgggttacccccattgccacgttgcgccatcctttttgcaatcagtgaccacttttccaagcaaaaataacgccaagcagaacgaagacgttctttttaagaagcgagaacaccagaagttcgtgctgtcggggcatgcggcgacgaattggcggataaaggggatctgcgttgaggtggatttcagttaatcaattggttaatctttcaggaccacctaagcaaatgctaaagtggcagatggaatgctgagccggcaagcacaggccttgacgttgcaaggtagtcatgaccgcagtgagcctctgatgttccgccgggtggatcatcccga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z