BBa_I723020 1 Pu Pu 2007-10-24T11:00:00Z 2015-08-31T04:07:54Z [Christine/Maia] This is the promoter activated by the transcriptional regulator XylR (BBa_I723136) in response to detection of environmental xylene. false false _126_ 0 2140 9 It's complicated false [Christine/Maia] true Scott Ramsay annotation1955192 1 Pu range1955192 1 1 320 BBa_K2023017 1 BBa_K2023017 Pu-RBS 2016-10-13T11:00:00Z 2016-10-20T03:44:37Z From Gluc coding device (BBa_K2023003) Pu-RBS false false _2490_ 30356 30230 9 false blabla false C??lia Chenebault component2506135 1 BBa_I723020 component2506137 1 BBa_B0034 annotation2506137 1 BBa_B0034 range2506137 1 329 340 annotation2506135 1 BBa_I723020 range2506135 1 1 320 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_I723020_sequence 1 cccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaatgttgtattttctcaactctgttcagattggttgctttcgccatgtatatcctcaaagcgggccagccgtagccgttacgc BBa_K2023017_sequence 1 cccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaatgttgtattttctcaactctgttcagattggttgctttcgccatgtatatcctcaaagcgggccagccgtagccgttacgctactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z