BBa_K2026001 1 pCpxP pCpxP, natural promoter acts as multiple carbon sources sensor 2016-07-19T11:00:00Z 2016-09-07T08:35:06Z Escherichia coli genome. In particular, Cpx regulon. pCpxP is a promoter acts as multiple carbon sources sensor with additional ability to sense particular extracellular stimuli such as alkaline pH[1][2], surface attachment[3] or accumulation of misfolded periplasmic proteins[4]. This part is flanked by standard biobrick restriction sites. Danese and Silhavy, 1998; Wolfe et al., 2008 Otto and Silhavy, 2002 false false _2493_ 32822 32822 9 true As the part is a promoter, there should be RBS sequence downstream of the pCpxP. false Qiulin Huang annotation2482626 1 pCpxP range2482626 1 1 121 BBa_K2026001_sequence 1 aggcagaaattacgtcatcagacgtcgctaatccatgactttacgttgttttacaccccctgacgcatgtttgcagcctgaatcgtaaactctctatcgttgaatcgcgacagaaagattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z