BBa_K2027047 1 BBa_K2027047 ATP aptamer 2016-10-17T11:00:00Z 2016-10-23T11:57:34Z We got the aptamer sequence from the following paper: https://tan.chem.ufl.edu/wp-content/uploads/sites/39/pubs/important-articles/Aptamer%20Switch%20Probe%20Based%20on%20Intramolecular%20Displacement.pdf This is a DNA sequence of an ATP aptamer. It will bind ATP with high specificity and affinity. Can be used alone for projects requiring binding, or integrated into sensors. false false _2494_ 29123 32789 9 false N/A false Julia Gross BBa_K2027047_sequence 1 cacctgggggagtattgcggaggaaggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z