BBa_K2027048 1 BBa_K2027048 Theophylline Aptamer 2016-10-17T11:00:00Z 2016-10-18T01:53:44Z We took the sequence for this part from the following paper: http://rnajournal.cshlp.org/content/17/3/478.long This is a non-coding RNA that encodes the theophylline binding aptamer. It can be used in both binding and sensing applications. false false _2494_ 32789 32789 9 false N/A. false Julia Gross BBa_K2027048_sequence 1 ataccagccgaaaggcccttggcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z