BBa_K2027050 1 BBa_K2027050 PQQ Aptamer #2 (15ADb11) 2016-10-23T11:00:00Z 2016-10-27T10:46:11Z Emahi et al. 2014 (http://www.rsc.org/suppdata/ra/c4/c4ra11052h/c4ra11052h1.pdf) This is a functional DNA sequence that encodes the pyrilloquinone quinone binding aptamer. It can be used in both binding and sensing applications. false false _2494_ 29123 29123 9 false This was one of the best two DNA aptamer candidates from SELEX (also see BBa_K2027050). false Michael Becich BBa_K2027050_sequence 1 gaactagatcgcagccccacagtcgagaagcagtaagacgacatgggaacaaacatggggccaagagatctagggcacgctgtgtggatcgaggtaatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z