BBa_K2027073 1 BBa_K2027073 (pMS-AFa-DEa) pAKP444 RBS 1 extraction 2016-10-24T11:00:00Z 2016-10-25T07:42:54Z Sequence was sourced from Turk SC, Kloosterman WP, Ninaber DK, et al. Metabolic Engineering toward Sustainable Production of Nylon-6. ACS Synth Biol. 2016;5(1):65-73. (http://pubs.acs.org/doi/full/10.1021/acssynbio.5b00129) (pMS-AFa-DEa) pAKP444 RBS 1 extraction Ribosome binding site extraction out of pAKP444 plasmid false false _2494_ 31619 31619 9 false No alterations were made to the sequence. false Gordon Sun BBa_K2027073_sequence 1 taataaggtaccaggaggaattaaccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z