BBa_K2028000 1 Orai1 V102 This part is the cDNA of a mutated calcium ion channel protein. 2016-10-13T11:00:00Z 2016-10-29T08:21:59Z This part comes from the cDNA of mutated Orai1 protein (V102A). This part encodes the gene of Calcium release-activated calcium channel protein 1 (Orai1), which is a part of calcium selective ion channel in humans. Orai1 calcium channels in the plasma membrane are activated by stromal interaction molecule-1 (STIM1), an endoplasmic reticulum calcium sensor, to mediate store-operated calcium entry (SOCE).Store-operated calcium (Ca2+) entry (SOCE) is activated in response to cellular stimuli that deplete the sarco/endoplasmic reticulum (ER) lumen of Ca2+, a prerequisite event that opens exquisitely Ca2+ selective plasma membrane (PM) channels, augmenting cytosolic Ca2+ levels and refilling ER stores. The principal molecular components of SOCE in many cell types include the ER-inserted stromal interaction molecule-1 (STIM1)3,4 and the Orai1 PM channel subunits5,6,7,8, which physically interact at ER???PM junctions in a functional Ca2+ release-activated Ca2+ (CRAC) channel complex. SOCE through CRAC channels is integral to myriad signalling pathways in electrically excitable and non-excitable cells, the most prominent being immune cells in which inheritable mutations in STIM1 and Orai1 have been linked to devastating immunodeficiency diseases. Therefore, we use this part to help with eliminating Ca2+ in hard water. false false _2495_ 30292 30292 9 false Usually, the protein Orai1 works only when the STIM1 channel is activated. However, we select the mutated protein that did not require the presistence of STIM1, which changed the 102th amino acid valine to alanine. false Zhongxiu Hu BBa_K2028000_sequence 1 atgagcctcaacgagcactccatgcaggcgctgtcctggcgcaagctctacttgagccgcgccaagcttaaagcctccagccggacctcggctctgctctccggcttcgccatggcggcaatggtggaggtgcagctggacgctgaccacgactacccaccggggctgctcatcgccttcagtgcctgcaccacagtgctggtggctgtgcacctgtttgcgctcatgatcagcacctgcatcctgcccaacatcgaggcggtgagcaacgtgcacaatctcaactcggtcaaggagtccccccatgagcgcatgcaccgccacatcgagctggcctgggccttctccaccgtcatcggcacgctgctcttcctagctgaggtggtgctgctctgctgggtcaagttcttgcccctcaagaagcagccaggccagccaaggcccaccagcaagccccccgccagtggcgcagcagccaacgtcagcaccagcggcatcaccccgggccaggcagctgccatcgcctcgaccaccatcatggttcccttcggactgatctttatcgtcttcgccgtccacttctaccgctcactggttagccataagaccgaccgacagttccaggagctcaacgagctggcggagtttgcccgcttacaggaccagctggaccacagaggggaccaccccctgacgcccggcagccactatgcctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z