BBa_K2029000 1 nprb P43_RBS_nprb 2016-08-28T11:00:00Z 2016-08-29T12:12:46Z p43_RBS_nprb sequence was taken from the p43NMK plasmid: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1169017/ Part consisting of the P43 promotor, RBS and coding sequence of the nprb signal peptide which induces secretion in B. subtilis. This part can be used to produce and secrete proteins in B. subtilis. false false _2496_ 27381 27381 9 false standard iGEM cloning site was replaced with analoge for scarless cloning false Max Schelski, Niklas Schmacke annotation2481961 1 start codon range2481961 1 300 302 annotation2481959 1 p43 promotor range2481959 1 1 280 annotation2481960 1 RBS range2481960 1 281 290 annotation2481962 1 nprb signal peptide range2481962 1 303 380 BBa_K2029000_sequence 1 tgataggtggtatgttttcgcttgaacttttaaatacagccattgaacatacggttgatttaataactgacaaacatcaccctcttgctaaagcggccaaggacgctgccgccggggctgtttgcgtttttgccgtgatttcgtgtatcattggtttacttatttttttgccaaagctgtaatggctgaaaattcttacatttattttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataaagtgatagcggtaccattatagtaagagaggaatgtacacatgcgcaacttgaccaagacatctctattactggccggcttatgcacagcggcccaaatggtttttgtaacacatgcctcagctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z