BBa_K2029001 1 sacB pP43_RBS_sacB 2016-08-28T11:00:00Z 2016-08-29T12:32:01Z http://aem.asm.org/content/70/9/5704.full#ref-23 Part consisting of the P43 promotor, RBS and coding sequence of the sacB signal peptide which induces secretion in B. subtilis. This part can be used to produce and secrete proteins in B. subtilis. false false _2496_ 27381 27381 9 false false Max Schelski, Niklas Schmacke annotation2481964 1 RBS range2481964 1 281 290 annotation2481965 1 start codon range2481965 1 300 302 annotation2481966 1 sacB signal peptide range2481966 1 332 411 annotation2481963 1 P43 promoter range2481963 1 1 280 BBa_K2029001_sequence 1 tgataggtggtatgttttcgcttgaacttttaaatacagccattgaacatacggttgatttaataactgacaaacatcaccctcttgctaaagcggccaaggacgctgccgccggggctgtttgcgtttttgccgtgatttcgtgtatcattggtttacttatttttttgccaaagctgtaatggctgaaaattcttacatttattttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataaagtgatagcggtaccaggagggctggaagaagcagaccgctaacacagtacataaaaaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcactgctggcaggaggcgcaactcaagcgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z