BBa_K2029014 1 BBa_K2029014 pLac_RBS 2016-10-13T11:00:00Z 2016-10-20T06:15:47Z Gene synthesis repressor binding site and ribosome binding site intended for enzyme excretion in Escherichia coli false false _2496_ 29985 29985 9 false This part serves as a control for protein expression. Any protein-coding gene succeeding this part will only be expressed when there's lactose ITPG present in the medium. false Bui Hoang Duy BBa_K2029014_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z