BBa_K2030000 1 pAQR1 pAQR1 <i>S. cerevisiae</i> promoter 2016-08-01T11:00:00Z 2016-10-17T01:02:27Z Genomic DNA from Saccharomyces cerevisiae CEN.PK113-5D. The upstream regulatory sequence to the gene AQR1, coding for a transporter that facilitates secretion of excess amino acids. false false _2497_ 27749 27749 9 false The complete sequence of Saccharomyces cerevisiae S288c chromosome XIV (Genbank accession number BK006947) was used to design primers for amplification of this promoter. FW: gccgcttctagagGTTCTGTTGCCGTATGCTATC RV: ttcttcctgcagcggccgctactagtaTGCTGATTCGACTTTCTGAATC The primers were designed to anneal at 64 degrees, using Phusion High-Fidelity DNA Polymerase. The uppercase nucleotides hybridizes with the template and the lowercase nucleotides contains the overhang. The overhang in the FW primer contains the last 13 bp of the prefix, which includes 6 protective bases before the XbaI site to ensure efficient cutting. The overhang in the RV primer contains the suffix with additional 6 protective bases to ensure efficient cutting with PstI. For assembly of this biobrick, the vector pSB1C3 (BBa_J04450) was cut with XbaI and PstI and purified from gel. The PCR product of pAQR1 was cut with XbaI and PstI and spin column purified. The two pieces was ligated and chemically transformed into E. coli DH5alpha and plated on LB + chloramphenicol. False positive colonies are red. White colonies were restreaked on LB + chloramphenicol and their plasmids extracted using miniprep. The plasmids were verified by digestion with XbaI and PstI, resulting in two bands: 2044 (vector) and 692 (pAQR1). The biobrick was then sent for sequencing for further verification. false John Hellgren annotation2481395 1 pAQR1 range2481395 1 1 666 BBa_K2030000_sequence 1 gttctgttgccgtatgctatctactcctaaggcttttttctactacggcaatctattcacaatgtgcaattaggctaaatgctaaaaaaagaaaaaaaaatccggagcccctcgatgactcctgtttccgttttatactgtccagcgcagaccgcacttcctacgtatacttcttacggggaagggagcatacacgaaaacaaaaggacccgtaatgactcggaaactccatagatcggtaaataccggctcgttacccgtcctccatcggaaaatctctcaccgatttgttccggtatcggataatttatgaatcacccggcttgatggaaccgtttttgttccgtgaaatgcccggcctgcattgttttcttcagacgagaagccgttccaacgtttctttttctcgtcaccgggaagttgcgggcaccttagggcaaggaaaaagaaacttctctgccctcatcgaggatacagttgatcatactcaatattatataacgcttaacactgtcaaggttatacactttttactaactttttattgctaatattgtcgttctatataaaattatggatttttccaggcttacaaagttagcatttatacggagataaatttatttttttgagaatccaagctagattcagaaagtcgaatcagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z