BBa_K2030003 1 pPYK2 pPYK2 <i>S. cerevisiae</i> promoter 2016-08-16T11:00:00Z 2016-10-17T01:03:17Z Genomic DNA from <i>Saccharomyces cerevisiae</i> CEN.PK113-5D. The upstream regulatory sequence to the gene <i>PYK2</i>, coding for Pyruvate Kinase. false false _2497_ 27749 27749 9 false The complete sequence of <i>Saccharomyces cerevisiae</i> S288c chromosome XV (Genbank accession number BK006948) was used to design primers for amplification of this promoter. FW: RV: The primers were designed to anneal at 63 ??C (although PCR worked better at 61 ??C), using Phusion High-Fidelity DNA Polymerase. The uppercase nucleotides hybridizes with the template and the lowercase nucleotides contains the overhang. The overhang in the FW primer contains the last 13 bp of the prefix, which includes 6 protective bases before the XbaI site to ensure efficient cutting. The overhang in the RV primer contains the suffix with additional 6 protective bases to ensure efficient cutting with PstI. For assembly of this biobrick, the vector pSB1C3 (BBa_J04450) was cut with XbaI and PstI and purified from gel. The PCR product of pPCK1 was cut with XbaI and PstI and spin column purified. The two pieces was ligated and chemically transformed into <i>E. coli</i> DH5&alpha; and plated on LB + chloramphenicol. False positive colonies still contain the RFP from BBa_J04450 and are red. White colonies were restreaked on LB + chloramphenicol and their plasmids extracted using miniprep. The plasmids were verified by digestion with XbaI and PstI, resulting in two bands: 2044 (vector) and 797 (pPCK1). The biobrick was then sent for sequencing for further verification. false John Hellgren annotation2481488 1 pPYK2 range2481488 1 1 436 BBa_K2030003_sequence 1 cgcttttatgaacatattccgatatctctcacgatactaatattcgaaaaatctttctccttcgccgcgatggatggaagtaaaaacacatatataaaagtataaaatgaatgctggcgtattcttacatacaagagatttgtaaaaagtcaatgaaaagttctccacacgtgtttttctcttttactttttttttcttccttttggtttccttttttctttctcgtcgcttttatttagcgacgcagcataggaaacaggggtaaagtgtcataactttttagagaaaatgatatatcattaatatgcacacgtttatataaatggagaaagaaaacaaagaacataaaacattttgaagcagagcggtgaaacgcaactatattttactttcatcctctacgtccattgtaagattacaacaaaagcactatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z