BBa_K203101 1 BBa_K203101 ER membrane targeting (C-terminal) 2009-10-14T11:00:00Z 2015-05-08T01:11:22Z Plasmid DNA This part is a protein domain of the Sar-1 GTPase known to localize to the ER membrane. It is very convenient as a localization signal to the ER for proteins to which it is fused. false false _301_ 0 5074 9 It's complicated false mutagenesis PCR to remove BBb restriction sites. false Michael Bartoschek and Douaa Mugahid BBa_K203101_sequence 1 tgtctggttttctgtcacatttcagaatacctaaaaatgaagaaattgtcttctcaattaaagaacattcatatacagcacaatacatgttgtaattactgctaatggtatgggtataagtgcatatctgtgtctagaatgaccgctgcttggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z