BBa_K2036008 1 BBa_K2036008 RBS-CIII-RBS-CIII,tandem expression 2016-09-18T11:00:00Z 2016-10-24T11:09:59Z come from bacteriaphage lambda RBS-CIII-RBS-CIII,as Ftsh normally exists in E.coli to degrade CII, CIII functions as a inhibitor of Ftsh, and tandom expression of CIII,may enhance the effect on Ftsh false false _2503_ 28503 25901 9 false According to the Registry, prefix of other sequence are supposed to be "GAATTCGCGGCCGCTTCTAGAG" , so the scar produced by 3A assembly should be "TACTAGAG" false Zhangyu Cheng annotation2484159 1 BBa_K2036006 range2484159 1 1 183 annotation2484158 1 spacer sequence range2484158 1 13 18 annotation2484160 1 RBS range2484160 1 192 203 annotation2484157 1 RBS range2484157 1 1 12 annotation2484162 1 BBa_K2036006 range2484162 1 192 374 annotation2484161 1 spacer sequence range2484161 1 204 209 BBa_K2036008_sequence 1 aaagaggagaaatacacgatgcaatatgccattgcagggtggcctgttgctggctgcccttccgaatctttacttgaacgaatcacccgtaaattacgtgacggatggaaacgccttatcgacatacttaatcagccaggagtcccaaagaatggatcaaacacttatggctatccagactaatactagagaaagaggagaaatacacgatgcaatatgccattgcagggtggcctgttgctggctgcccttccgaatctttacttgaacgaatcacccgtaaattacgtgacggatggaaacgccttatcgacatacttaatcagccaggagtcccaaagaatggatcaaacacttatggctatccagactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z