BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K2039005 1 BBa_K2039005 Coding sequences of protein GFP 1.9 (subunit of tripartite GFP) 2016-10-13T11:00:00Z 2016-10-14T10:15:40Z Synthetic This part is the complementary part of Bba_K2039004 and Bba_K203003. The tripartite split-GFP is composed of two times of 20 amino-acids long GFP tags (GFP 10 and GFP 11) and a third complementary subsection (GFP 1-9). false false _2506_ 31202 31202 9 false No specific consideration false Maxence Pfeiffer BBa_K2039006 1 BBa_K2039006 Part expressing the protein GFP 1.9 (subunit of tripartite GFP) 2016-10-13T11:00:00Z 2016-10-14T10:18:53Z Synthetic This part is the complementary part of Bba_K2039000 and Bba_K2039001. The tripartite split-GFP is composed of two times of 20 amino-acids long GFP tags (GFP 10 and GFP 11) and a third complementary subsection (GFP 1-9). false false _2506_ 31202 31202 9 false No specific consideration false Maxence Pfeiffer component2506841 1 BBa_B0030 component2506839 1 BBa_J23119 component2506850 1 BBa_B0015 component2506843 1 BBa_K2039005 annotation2506850 1 BBa_B0015 range2506850 1 708 836 annotation2506839 1 BBa_J23119 range2506839 1 1 35 annotation2506843 1 BBa_K2039005 range2506843 1 67 699 annotation2506841 1 BBa_B0030 range2506841 1 44 58 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K2039006_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagattaaagaggagaaatactagagtactagatgcgcaaaggcgaagaactgtttaccggcgtggtgccgattctgattgaactggatggcgatgtgaacggccataaattttttgtgcgcggcgaaggcgaaggcgatgcgaccattggcaaactgagcctgaaatttatttgcaccaccggcaaactgccggtgccgtggccgaccctggtgaccaccctgacctatggcgtgcagtgctttagccgctatccggatcatatgaaacgccatgatttttttaaaagcgcgatgccggaaggctatgtgcaggaacgcaccatttattttaaagatgatggcacctataaaacccgcgcggaagtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcattgattttaaagaagatggcaacattctgggccataaactggaatataactttaacagccataaagtgtatattaccgcggataaacagaacaacggcattaaagcgaactttaccattcgccataacgtggaagatggcagcgtgcagctggcggatcattatcagcagaacaccccgattggcgatggcccggtgctgctgccgtaataacgctgatagtgctagtgtagatcgctactagagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2039005_sequence 1 tactagatgcgcaaaggcgaagaactgtttaccggcgtggtgccgattctgattgaactggatggcgatgtgaacggccataaattttttgtgcgcggcgaaggcgaaggcgatgcgaccattggcaaactgagcctgaaatttatttgcaccaccggcaaactgccggtgccgtggccgaccctggtgaccaccctgacctatggcgtgcagtgctttagccgctatccggatcatatgaaacgccatgatttttttaaaagcgcgatgccggaaggctatgtgcaggaacgcaccatttattttaaagatgatggcacctataaaacccgcgcggaagtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcattgattttaaagaagatggcaacattctgggccataaactggaatataactttaacagccataaagtgtatattaccgcggataaacagaacaacggcattaaagcgaactttaccattcgccataacgtggaagatggcagcgtgcagctggcggatcattatcagcagaacaccccgattggcgatggcccggtgctgctgccgtaataacgctgatagtgctagtgtagatcgctactagag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z