BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K204032 1 BBa_K204032 3OH,C14 : 1-HSL receiver 2009-10-11T11:00:00Z 2015-05-08T01:11:22Z p(tetR)+RBS+cinR+terminater+p(cinR)<br> 3OH,C14 : 1-HSL receiver<br> p(tetR)+RBS+cinR+terminater+p(cinR)<br> false false _304_ 0 5360 9 It's complicated false p(tetR)+RBS+cinR+terminater+p(cinR)<br> false Uno Keisuke component2262908 1 BBa_B0034 component2262923 1 BBa_R0078 component2262919 1 BBa_B0015 component2262912 1 BBa_C0077 component2262902 1 BBa_R0040 annotation2262919 1 BBa_B0015 range2262919 1 876 1004 annotation2262923 1 BBa_R0078 range2262923 1 1013 1237 annotation2262912 1 BBa_C0077 range2262912 1 81 867 annotation2262908 1 BBa_B0034 range2262908 1 63 74 annotation2262902 1 BBa_R0040 range2262902 1 1 54 BBa_C0077 1 cinr cinR activator from Rhizobium leguminosarum (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Rhizobium leguminosarum Released HQ 2013 In complex with O3-C14:1-HSL (made by BBa_C0076), CinR binds to the Cin promoter (BBa_R0077) and activates transcription. false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 <P>Change log: original STOP: tag -> taATAA true crackdots annotation301112 1 cinR range301112 1 1 723 annotation306600 1 LVA range306600 1 724 756 annotation2214000 1 Help:Barcodes range2214000 1 763 787 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_R0078 1 cinR Promoter (cinR and HSL regulated) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Rhizobium leguminosarum Released HQ 2013 false false _1_ 0 24 7 In stock false true Drew Endy annotation318234 1 unidentified/uncharacterized CinR dependent range318234 1 1 220 annotation318244 1 stem_loop range318244 1 35 74 annotation318250 1 stem_loop range318250 1 91 136 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K204032_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgattgagaatacctatagcgaaaagttcgagtccgcgttcgaacagatcaaggcggcggccaacgtggatgccgccatccgtattctccaggcggaatataacctcgatttcgtcacctaccatctcgcccagacgatcgcgagcaagatcgattcgcccttcgtgcgcaccacctatccggatgcctgggtttcccgctacctcctcaacagctatgtgaaggtcgatccgatcgtcaagcagggcttcgaacgccagctgcccttcgactggagcgaggtcgaaccgacgccggaggcctatgccatgctggtcgacgcccagaaacacggcatcggtggcaatggctactccatccccgtcgccgacaaggcgcagcgccgcgccctgctgtcgctgaatgcccgtataccggccgacgaatggaccgagctcgtgcgccgctgccgcaacgagtggatcgagatcgcccatctgatccaccgcaaggccgtctatgagctgcatggcgaaaacgatccggtgccggcattgtcgccgcgcgagatcgagtgtctgcactggaccgccctcggcaaggattacaaggatatttcggtcatcctgggcatatcagagcataccacacgcgattacctgaagaccgcccgcttcaagctcggctgcgccacgatctcggccgccgcgtcgcgggctgttcaattgcgcatcatcaatcccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0078_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0077_sequence 1 atgattgagaatacctatagcgaaaagttcgagtccgcgttcgaacagatcaaggcggcggccaacgtggatgccgccatccgtattctccaggcggaatataacctcgatttcgtcacctaccatctcgcccagacgatcgcgagcaagatcgattcgcccttcgtgcgcaccacctatccggatgcctgggtttcccgctacctcctcaacagctatgtgaaggtcgatccgatcgtcaagcagggcttcgaacgccagctgcccttcgactggagcgaggtcgaaccgacgccggaggcctatgccatgctggtcgacgcccagaaacacggcatcggtggcaatggctactccatccccgtcgccgacaaggcgcagcgccgcgccctgctgtcgctgaatgcccgtataccggccgacgaatggaccgagctcgtgcgccgctgccgcaacgagtggatcgagatcgcccatctgatccaccgcaaggccgtctatgagctgcatggcgaaaacgatccggtgccggcattgtcgccgcgcgagatcgagtgtctgcactggaccgccctcggcaaggattacaaggatatttcggtcatcctgggcatatcagagcataccacacgcgattacctgaagaccgcccgcttcaagctcggctgcgccacgatctcggccgccgcgtcgcgggctgttcaattgcgcatcatcaatcccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z