BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E2050 1 mRFP1 derivative of mRFP1, yeast-optimized 2005-01-24T12:00:00Z 2016-01-25T02:35:54Z Shaner et al, 2004. Nat Biotech (22):1567-1571 Released HQ 2013 mRFP derivative. Ex548nm/Em562. yeast codon optimized. false false _8_ 4206 230 7 In stock false Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2060 (mCherry), BBa_E2020 (Cerulean CFP), and BBa_E2030 (Venus YFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. except for 5' and 3' ends no significant sequence identity runs to mCherry (BBa_E2060). true ryu annotation1431919 1 GSGTA linker range1431919 1 724 738 annotation1431920 1 mOrange range1431920 1 1 738 annotation2214024 1 Help:Barcodes range2214024 1 745 769 annotation1431915 1 MATSG linker range1431915 1 1 15 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_K204048 1 BBa_K204048 placI + mOrange 2009-10-14T11:00:00Z 2015-05-08T01:11:23Z placI + mOrange placI + mOrange false false _304_ 0 5360 9 It's complicated false placI + mOrange false Uno Keisuke component2256132 1 BBa_R0010 component2256152 1 BBa_B0015 component2256145 1 BBa_E2050 component2256140 1 BBa_B0034 annotation2256152 1 BBa_B0015 range2256152 1 1004 1132 annotation2256145 1 BBa_E2050 range2256145 1 227 995 annotation2256132 1 BBa_R0010 range2256132 1 1 200 annotation2256140 1 BBa_B0034 range2256140 1 209 220 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_E2050_sequence 1 atggcaactagcggcatggttagtaaaggagaagaaaacaatatggcaatcataaaagaatttatgagattcaaagtcagaatggaaggttctgtaaatggtcacgagttcgaaatagaaggggaaggtgaaggtagaccctatgaaggctttcaaacggctaaattaaaagttaccaagggtggaccattgccctttgcttgggatatcctgtctcctcagttcacttatggtagtaaagcctatgttaagcatcctgctgatattcctgattacttcaagttgagttttccagaaggtttcaaatgggagagagttatgaattttgaagatggcggagttgtgacagtgacacaagactcctcacttcaagacggtgagtttatttacaaggtaaaactacgtggcactaactttccgtcggatggaccagtcatgcaaaaaaagacgatgggttgggaggcttcatctgagcgaatgtatccagaagatggggcactaaagggcgaaattaagatgaggctcaaattaaaggatggtggacattatacctcggaagtgaaaactacctataaagccaaaaagccagttcaattacctggtgcatacattgttggcattaagttggacatcacaagccacaatgaagattatacaatagtagagcagtacgaacgcgcggaaggtaggcattctactggaggcatggatgaactatacaaaggttctggtaccgcataataactctgatagtgctagtgtagatctc BBa_K204048_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaaaacaatatggcaatcataaaagaatttatgagattcaaagtcagaatggaaggttctgtaaatggtcacgagttcgaaatagaaggggaaggtgaaggtagaccctatgaaggctttcaaacggctaaattaaaagttaccaagggtggaccattgccctttgcttgggatatcctgtctcctcagttcacttatggtagtaaagcctatgttaagcatcctgctgatattcctgattacttcaagttgagttttccagaaggtttcaaatgggagagagttatgaattttgaagatggcggagttgtgacagtgacacaagactcctcacttcaagacggtgagtttatttacaaggtaaaactacgtggcactaactttccgtcggatggaccagtcatgcaaaaaaagacgatgggttgggaggcttcatctgagcgaatgtatccagaagatggggcactaaagggcgaaattaagatgaggctcaaattaaaggatggtggacattatacctcggaagtgaaaactacctataaagccaaaaagccagttcaattacctggtgcatacattgttggcattaagttggacatcacaagccacaatgaagattatacaatagtagagcagtacgaacgcgcggaaggtaggcattctactggaggcatggatgaactatacaaaggttctggtaccgcataataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z