BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K204052 1 BBa_K204052 ptetR + mOrange 2009-10-15T11:00:00Z 2015-05-08T01:11:23Z ptetR + mOrange ptetR + mOrange false false _304_ 0 5360 9 It's complicated false ptetR + mOrange false Uno Keisuke component2256179 1 BBa_B0034 component2256173 1 BBa_R0040 component2256191 1 BBa_B0015 component2256184 1 BBa_E2050 annotation2256179 1 BBa_B0034 range2256179 1 63 74 annotation2256191 1 BBa_B0015 range2256191 1 858 986 annotation2256184 1 BBa_E2050 range2256184 1 81 849 annotation2256173 1 BBa_R0040 range2256173 1 1 54 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E2050 1 mRFP1 derivative of mRFP1, yeast-optimized 2005-01-24T12:00:00Z 2016-01-25T02:35:54Z Shaner et al, 2004. Nat Biotech (22):1567-1571 Released HQ 2013 mRFP derivative. Ex548nm/Em562. yeast codon optimized. false false _8_ 4206 230 7 In stock false Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2060 (mCherry), BBa_E2020 (Cerulean CFP), and BBa_E2030 (Venus YFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. except for 5' and 3' ends no significant sequence identity runs to mCherry (BBa_E2060). true ryu annotation1431919 1 GSGTA linker range1431919 1 724 738 annotation1431920 1 mOrange range1431920 1 1 738 annotation2214024 1 Help:Barcodes range2214024 1 745 769 annotation1431915 1 MATSG linker range1431915 1 1 15 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K204052_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaaaacaatatggcaatcataaaagaatttatgagattcaaagtcagaatggaaggttctgtaaatggtcacgagttcgaaatagaaggggaaggtgaaggtagaccctatgaaggctttcaaacggctaaattaaaagttaccaagggtggaccattgccctttgcttgggatatcctgtctcctcagttcacttatggtagtaaagcctatgttaagcatcctgctgatattcctgattacttcaagttgagttttccagaaggtttcaaatgggagagagttatgaattttgaagatggcggagttgtgacagtgacacaagactcctcacttcaagacggtgagtttatttacaaggtaaaactacgtggcactaactttccgtcggatggaccagtcatgcaaaaaaagacgatgggttgggaggcttcatctgagcgaatgtatccagaagatggggcactaaagggcgaaattaagatgaggctcaaattaaaggatggtggacattatacctcggaagtgaaaactacctataaagccaaaaagccagttcaattacctggtgcatacattgttggcattaagttggacatcacaagccacaatgaagattatacaatagtagagcagtacgaacgcgcggaaggtaggcattctactggaggcatggatgaactatacaaaggttctggtaccgcataataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E2050_sequence 1 atggcaactagcggcatggttagtaaaggagaagaaaacaatatggcaatcataaaagaatttatgagattcaaagtcagaatggaaggttctgtaaatggtcacgagttcgaaatagaaggggaaggtgaaggtagaccctatgaaggctttcaaacggctaaattaaaagttaccaagggtggaccattgccctttgcttgggatatcctgtctcctcagttcacttatggtagtaaagcctatgttaagcatcctgctgatattcctgattacttcaagttgagttttccagaaggtttcaaatgggagagagttatgaattttgaagatggcggagttgtgacagtgacacaagactcctcacttcaagacggtgagtttatttacaaggtaaaactacgtggcactaactttccgtcggatggaccagtcatgcaaaaaaagacgatgggttgggaggcttcatctgagcgaatgtatccagaagatggggcactaaagggcgaaattaagatgaggctcaaattaaaggatggtggacattatacctcggaagtgaaaactacctataaagccaaaaagccagttcaattacctggtgcatacattgttggcattaagttggacatcacaagccacaatgaagattatacaatagtagagcagtacgaacgcgcggaaggtaggcattctactggaggcatggatgaactatacaaaggttctggtaccgcataataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z