BBa_K2041017 1 BBa_K2041017 the binding site of miR-21 2016-10-13T11:00:00Z 2016-10-14T09:19:08Z The binding site of miR-21 is designed by biological campany. When microRNA-21 binds to the binding site of miR-21,it can inhibit the expression of downstream sequence. true false _2508_ 28085 28085 9 false This basic part should bind to the microRNA-21 well. false YANG YUANZHAN annotation2511514 1 binding site of miR-21 range2511514 1 1 22 BBa_K2041017_sequence 1 tagcttatcagactgatgttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z