##gff-version 3
##sequence-region BBa_K2041019 1 158
BBa_K2041019	.	sequence_feature	64	158	.	+	0	ID=BBa_K2041018;Name=BBa_K2041018
BBa_K2041019	.	non_covalent_binding_site	112	134	.	+	0	ID=annotation2511581;Name=the binding site 3 of miR-155;Parent=BBa_K2041018
BBa_K2041019	.	non_covalent_binding_site	64	86	.	+	0	ID=annotation2511578;Name=the binding site 1 of miR-155;Parent=BBa_K2041018
BBa_K2041019	.	non_covalent_binding_site	88	110	.	+	0	ID=annotation2511579;Name=the binding site 2 of miR-155;Parent=BBa_K2041018
BBa_K2041019	.	non_covalent_binding_site	136	158	.	+	0	ID=annotation2511580;Name=the binding site 4 of miR-155;Parent=BBa_K2041018
BBa_K2041019	.	promoter	1	35	.	+	0	ID=BBa_J23104;Name=BBa_J23104
BBa_K2041019	.	ribosome_entry_site	44	55	.	+	0	ID=BBa_B0034;Name=BBa_B0034
BBa_K2041019	.	conserved_region	48	51	.	+	0	ID=annotation23325;Name=conserved;Parent=BBa_B0034
>BBa_K2041019
ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagagacccctatcacgatta
gcattaagacccctatcacgattagcattaagacccctatcacgattagcattaagacccctatcacgattagcattaa