BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2041019 1 BBa_K2041019 promoter-RBS-the binding site of miR-155 2016-10-13T11:00:00Z 2016-10-14T09:05:19Z The promoter is from Kit Plate of iGEM foundation and the binding site of miR-155 is synthesised by SinoGeno Max Co. Ltd. When microRNA-155 binds to the binding site of miR-155,it can inhibit the expression of downstream sequence. Four binding sites can improve the rate of the binding between the miR-155 and it's binding site. false false _2508_ 28085 28085 9 false This composite part includes a constitutive promoter and four binding sites of miR-155. false YANG YUANZHAN component2511698 1 BBa_J23104 component2511705 1 BBa_K2041018 component2511700 1 BBa_B0034 annotation2511705 1 BBa_K2041018 range2511705 1 64 158 annotation2511698 1 BBa_J23104 range2511698 1 1 35 annotation2511700 1 BBa_B0034 range2511700 1 44 55 BBa_K2041018 1 BBa_K2041018 the binding site of miR-155 2016-10-13T11:00:00Z 2016-10-14T08:49:25Z The binding site of miR-155 is designed by biological campany. When microRNA-155 binds to the binding site of miR-155 which contains 4 binding sites,it can inhibit the expression of downstream sequence. false false _2508_ 28085 28085 9 false This basic part should bind to the microRNA-155 well. false YANG YUANZHAN annotation2511579 1 the binding site 2 of miR-155 range2511579 1 25 47 annotation2511578 1 the binding site 1 of miR-155 range2511578 1 1 23 annotation2511581 1 the binding site 3 of miR-155 range2511581 1 49 71 annotation2511580 1 the binding site 4 of miR-155 range2511580 1 73 95 BBa_K2041019_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagagacccctatcacgattagcattaagacccctatcacgattagcattaagacccctatcacgattagcattaagacccctatcacgattagcattaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K2041018_sequence 1 acccctatcacgattagcattaagacccctatcacgattagcattaagacccctatcacgattagcattaagacccctatcacgattagcattaa BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z