BBa_K2044000 1 BBa_K2044000 Based on our project, <2-6-8> is the optimal pathway scheme from Site No. 2 to Site No. 8 2016-09-28T11:00:00Z 2016-10-09T05:20:05Z The 8 sites and 13 lines designed and synthesized by ourselves undergo a series of chemical reactions, such as, bridge-PCR, DNA ligation, PCR, DNA gel electroresis and extraction. Finally, we obtain the feasible pathway<2-4-8>. The DNA sequence corresponding to the feasible pathway from Site No. 2 to Site No. 8 can be applied to biocomputing and directed biological navigation. false false _2511_ 32109 32109 9 false First, 8 sites were designed in the map. Every site contains 40bp DNA sequence at random and every adjacent site is connected by line, which adds up to 13 lines. Lines are represented by 52bp DNA single strand, with 20 complementary base pairs respectively from the first and last sites and 12bp information bit in the middle. The pre-4bp sequences contain the information of identification point, the mid-4bp sequences contain the information of the specified line, and the post-4bp contain the information of the path length. Next, we blend the corresponding DNA sequence of the 8 sites and 13 lines. Then, we make them react with one another through molecular biological approaches. The experiment can be proved viable if we can obtain a series of feasible pathway from Site No. 2 to Site No. 8. false Ding Haojie BBa_K2044000_sequence 1 gtaatgatctcctaggagatacattcgatcgatcatgctacccctgagtatattacgagctcgcgataccttgtcagtagtgcatgcagtgcccccaggtttgagtacagtacggtaccgtacccgtgacgtacgtgatgactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z