BBa_K2044020 1 BBa_K2044020 Based on our project, it represents Site NO.6 in the map. 2016-10-12T11:00:00Z 2016-10-13T12:38:20Z It is a self-designed DNA single strand comprised of 40bp at random, which is directly synthesized by HongXun Biological Science and Technology Co., Ltd in SuZhou, Jiangsu province. It is a self-designed DNA single strand comprised of 40bp at random, which is used as the raw material to synthesize all feasible pathways including Site NO.6. false false _2511_ 32109 32109 9 false We have designed 8 DNA single strands all comprised of 40bp at random, which represent respectively the 8 sites in the map in our project. false Ding Haojie BBa_K2044020_sequence 1 ttacgagctcgcgataccttgtcagtagtgcatgcagtgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z