BBa_K2047002 1 BBa_K2047002 Stem-loop with free energy of -14.9 kcal/mol measured by Mfold 2016-10-13T11:00:00Z 2016-10-21T12:48:57Z NO This sequence encodes a stem loop that can regulate multiple gene expression when inserted in intergenic region followed with a RNaseE site in E.coli. Different stem loops have different regulation effects and we quantitatively weighed this difference by their free energy evaluated by a software---Mfold .Of which the free energy of the most stable secondary structure of this sequence is -14.9 kcal/mol. false false _2514_ 30452 30440 9 false None false Yu Jiang BBa_K2047002_sequence 1 gtcgacgatcgcgtccaagttacatgattcttggacgccgcggctagcgtgaaaatacgagaatattatttgtattgatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z