BBa_K2047005 1 BBa_K2047005 Stem-loop with free energy of -30.1kcal/mol measured by Mfold 2016-10-13T11:00:00Z 2016-10-21T12:50:07Z No This sequence encodes a stem loop that can regulate multiple gene expression when inserted in intergenic region followed with a RNaseE site in E.coli. Different stem loops have different regulation effects and we quantitatively weighed this difference by their free energy evaluated by a software---Mfold .Of which the free energy of the most stable secondary structure of this sequence is -30.1 kcal/mol. false false _2514_ 30452 30440 9 false none false Yu Jiang BBa_K2047005_sequence 1 gtcgacgatcgtctcacacgtgctcattacatgatttgagcacgtgtgagaccgcggctagcgtgaaaatacgagaatattatttgtattgatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z