BBa_K2047008 1 BBa_K2047008 Stem-loop with free energy of -38.8kcal/mol measured by Mfold 2016-10-13T11:00:00Z 2016-10-21T12:53:05Z no This sequence encodes a stem loop that can regulate multiple gene expression when inserted in intergenic region followed with a RNaseE site in E.coli. Different stem loops have different regulation effects and we quantitatively weighed this difference by their free energy evaluated by a software---Mfold .Of which the free energy of the most stable secondary structure of this sequence is -38.8 kcal/mol. false false _2514_ 30452 30440 9 false none false Yu Jiang BBa_K2047008_sequence 1 gtcgacgatcctgctctactcaagtcgtctgttacatgattcagacgacttgagtagagcagcgcggctagcgtgaaaatacgagaatattatttgtattgatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z