BBa_K205001 1 GroES GroES is a chaperone protein that prevents polypeptide misfolding. 2009-09-07T11:00:00Z 2015-05-08T01:11:23Z Christos Kyratsous Columbia Univ, Coll Phys & Surg, Dept Microbiol, New York, NY 10032 USA Ref: Kyratsous, CA, Silverstein, SJ, DeLong, CR, Panagiotidis, CA. (2009) "Chaperone-fusion expression plasmid vectors for improved solubility of recombinant proteins in Escherichia coli" GENE VOL: 440 Issue: 1-2 Pages: 9-15 Date: Jul 1 2009 GroES is a chaperone protein that is responsible for the prevention of polypeptide mis-folding. In conjunction with GroEL, these two subunits form an assembly dimer that are promote efficient protein folding, especially under stressful conditions such as heat shock. This chaperone protein belongs to the eukaryotic HSP60 (heat shock protein) family. false false _311_ 0 4235 9 Not in stock false Gene was provided by Christos Kyratsous. false Richard Schlegel annotation2027304 1 End of GroES range2027304 1 292 294 annotation2027303 1 Start of GroES range2027303 1 1 3 BBa_K205001_sequence 1 atgaatattcgtccattgcatgatcgcgtgatcgtcaagcgtaaagaagttgaaactaaatctgctggcggcatcgttctgaccggctctgcagcggctaaatccacccgcggcgaagtgctggctgtcggcaatggccgtatccttgaaaatggcgaagtgaagccgctggatgtgaaagttggcgacatcgttattttcaacgatggctacggtgtgaaatctgagaagatcgacaatgaagaagtgttgatcatgtccgaaagcgacattctggcaattgttgaagcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z