BBa_K205004 1 BBa_K205004 MerT - Membranous Mercury transporter 2009-10-19T11:00:00Z 2016-01-28T12:25:29Z Sequenced sourced from Professor David Wilson, of the Department of Molecular Biology and Genetics, Cornell University. MerT is a transporter responsible for the crossing of the inner membrane by mercury. It enhances mercury uptake from the environment. false false _311_ 4206 4184 9 In stock false Standard 23 prefix and suffix was added to the sequence. false Katelin Haynes BBa_K205004_sequence 1 atgtctgaacctcaaaacgggcgcggggcgctcttcactggcgggctagccgccatcctcgcctcggcttgctgcctggggccgctggttctgatcgccctggggttcagcggcgcttggatcggcaacttgacggtgttggaaccttatcgcccgatcttcatcggcgcggcgttggtggcgctgtttttcgcctggcggcgcatctaccgaccggcgcaagcctgcaaaccaggggatgtgtgtgcgattccccaagtgcgcgctacttacaagctcattttctgggtcgtggccgcgctggttctggtcgcgctcggatttccctacgtcatgccatttttctattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z